IMIS - Marine Research Groups | Compendium Coast and Sea

IMIS - Marine Research Groups

[ report an error in this record ] Print this page

Bacteria (16S ssu rRNA) in an Antarctic snow sample
Citation
Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2 https://doi.org/10.15468/lp7r84

Access data
Archived data
Availability: Creative Commons License This dataset is licensed under a Creative Commons Attribution 4.0 International License.

Description
Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E). more

Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used.

Study Extent: Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E)

Quality Control: Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions.

Method step description:

  1. Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
  2. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
  3. Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
  4. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.

Scope
Keywords:
Terrestrial, Dna sequencing, Metadata, Snow, Antarctica, Bacteria

Geographical coverage
Antarctica [Marine Regions]

Temporal coverage
From 2010 on [Completed]

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Molecular data

Contributors
University of Messina, moredata creator
Vrije Universiteit Brussel (VUB), moredata creator
Belgian Nuclear Research Centre, moredata creator
Italian National Research Council (CNR), moredata creator

Related datasets
Published in:
AntOBIS: Antarctic Ocean Biodiversity Information System, more
(Partly) included in:
RAS: Register of Antarctic Species, more

Dataset status: Completed
Data type: Metadata
Data origin: Research: field survey
Metadatarecord created: 2019-03-28
Information last updated: 2019-04-10
All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy