IMIS - Marine Onderzoeksgroepen | Compendium Kust en Zee

IMIS - Marine Onderzoeksgroepen

[ meld een fout in dit record ] Print deze pagina
Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains
Citatie
Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4 https://doi.org/10.15468/ulq7je
Contact: Tytgat, Bjorn
Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.
Beschrijving
Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. meer

Geographic coverage: Sor Ronda Mountains, East Antarctica
Taxonomic coverage: 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8-27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536-516).
Scope
Thema's:
Biologie > Organisch (& bio-) chemie
Kernwoorden:
Terrestrisch, Bodem, Metadata, Sequencing, Antarctica, Bacteria
Geografische spreiding
Antarctica [Marine Regions]
Spreiding in de tijd
1 Januari 2009 - 1 Januari 2010
Taxonomic coverage
Bacteria [WoRMS]
Parameter
Moleculaire data
Bijdrage door
Universiteit Gent (UGent), meer, data creator
Tytgat, Bjorn
Vyverman, Wim
Willems, Anne
Verleyen, Elie
Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biodiversity Information System, meer
(Gedeeltelijk) opgenomen in:
RAS: Register of Antarctic Species, meer
Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2018-12-04
Informatie laatst gewijzigd: 2019-04-10
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid